Superfect transfection reagent was from QIAGEN (Valencia, CA, USA). Anti-V5, mammalian expression plasmid pcDNA3.1/His-V5-topo, Escherichia coli Top10 competent cells and lipofectamine RNAi MAX reagent were purchased from Life Technologies (Gaithersburg, Maryland, USA). Antibodies against phospho-p38, p38, phospho-I-κB, HA tag, K48 ubiquitin, K63 ubiquitin, and ubiquitin were from Cell Signaling (Beverly, MA, USA). Anti-USP13 was purchased from Bethyl Laboratories (Montgomery, TX, USA). Anti-USP13 and anti-I-κB were purchased from ProteinTech (Chicago, IL, USA). Immobilized protein A/G beads and control IgG, anti-Sigirr (for mouse, rat, and human origin), anti-phospho-JNK1, anti-JNK1, anti-NF-κB p65, anti-GAPDH, anti-IL-1β, and anti-Lamin A/C and anti-TLR4 were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). MG-132 was from EMD Chemicals (Gibbstown, NJ, USA). Cycloheximide, leupeptin, and LPS were from Sigma Aldrich (St Louis, MO, USA). Recombinant human IL-37 (a truncated form, Lys27-Asp192) was from R&D Systems (Minneapolis, MN, USA). Human TLR4 stable transfected HEK293 (HEK293/TLR4) cells were from InvivoGen (San Diego, CA, USA). Human macrophage-like cells (monocyte-derived macrophages differentiated in vitro with M-CSF and IL-4) were purchased from StemCell Technologies (Vancouver, BC, Canada). Mouse lung epithelial cells (MLE12, SV40-immortalized mouse alveolar cell line with epithelial characteristics), RAW 264.7 cells (mouse macrophage-like virus-induced leukemia cell line), and BEAS-2B (human lung epithelial cell line) were obtained from American Type Culture Collection (ATCC, Manassas, VA). 2.3 H&E staining and immunohistochemistry C57/BL6 mice were given 50 μl lentivirus vectors (2 × 10 7 plaque-forming units per mouse) via intratracheal administration for 5 d before intratracheal challenge with LPS or PA103 (doses described above). For lentiviral vector delivery system, cDNA encoding human Sigirr was inserted into the pLVX-IRES-tdTomato vector (Clontech, Palo Alto, CA, USA) lentiviral vectors encoding Sigirr and their controls were generated with a lentivirus packaging system (Clontech, Palo Alto, CA, USA). Cytospin preparations of BAL cells were stained with hematoxylin and eosin and viewed under light microscopy for inflammatory cell differential. The cell pellets were diluted in 1 ml sterile PBS, and the cells were counted with a hemocytometer. The cell-free supernatants were harvested for ELISA assay after centrifuging at 1000 rpm for 5 min. For BAL collection, the lungs were lavaged two times with 1 ml sterile PBS at room temperature. At designated time points after LPS or PA103 challenge, the mice were anesthetized before myocardial perfusions were performed with PBS via the right ventricle until lungs were cleared of blood, and then lungs were harvested for further analyses. aeruginosa (strain PA103 1 × 10 4 colony-forming units per mouse). Briefly, mice were given intratracheal administration of LPS (1 mg per kg body weight) or P. Lung inflammation models were performed by intratracheal administration of LPS or P. All animal experiments were approved by an institutional animal care and use committee (IACUC) at the University of Pittsburgh and the Ohio State University Animal Resources Centers. aeruginosa-induced murine models of lung injuryĪll mice were housed in the specific pathogen-free animal care facility at the University of Pittsburgh and the Ohio State University in accordance with institutional guidelines and guidelines of the US National Institutes of Health. Sex-matched Usp13 +/+ and Usp13 −/− littermates at 8–10 weeks were used for animal studies. Usp13 +/− mice identified by genotyping through PCR were intercrossed for the generation of Usp13 −/− mice. The F1 Usp13 +/− mice were further crossed with C57BL/6 background for at least 6 generations before use. Chimeric offspring were crossed with C57BL/6 to generate Usp13 +/− mice. A 481 bp or an approximately 600 bp fragment was produced from the WT allele or the null allele, respectively. The potential founder F0 mice were genotyped based on genomic DNA isolated from mouse tails by PCR with the following primer sets: F52: CTAGGTGGTCCTGGGCTTTG, R52: CAGGCTCATGAGTCACCACA, and R31: ACTCACTATGGCCTCAGCAA. The RNA sequence guides are GTGTGCCCGATGTGACCTGC and TCGAGGTGGACTTATGCACA. In brief, Cas9 mRNA and two sgRNA were injected into the fertilized embryos, and then embryos in 2-cell stages were transferred to oviducts of pseudopregnant female mice. Only the Usp13 gene is localized in the position on chromosome 3 ( ). Exon 6 and Intron 18 of Usp13 (chromosome 3 between position 32,865,806 and 32,917,828) were deleted. The Usp13 −/− mice were generated by the CRISPR/Cas9 system at the University of Pittsburgh. The Lancet Regional Health – Western Pacific.The Lancet Regional Health – Southeast Asia.The Lancet Gastroenterology & Hepatology.
0 Comments
Leave a Reply. |