For an all-round great solution, then Adobe Audition as the highest FindrScore. If the price is a big factor to you, the GarageBand might be worth looking at. Here are a few alternatives with similar features that users on our platform also looked at.įor a more in-depth breakdown, we always recommend checking out the dedicated alternative page which gives more data on why which solution is recommended. Whichever solution you go with, please come back and leave a review for that product so others can benefit from your experience. Both have pros and cons and which you choose will depend on your integration needs, pricing and more. Hopefully, you now have a clear picture of Logic Pro X and Adobe Audition pricing, features and user-experience provided these solutions. Looking at the data gathered on our platform Adobe Audition has a higher FindrScore of 70 which indicates that it could be a better fit over Logic Pro X However, you get a lot more functionality and flexibility with Logic Pro X which you may need to take into consideration. It’s a win for Adobe Audition! Adobe Audition offers Mail, Forum which users are happy with. This ranking data gives you a better understanding of how these solutions stack up in various use cases. One moment, please.Adobe Audition vs Pro Tools – An Honest Review -Updated May – Guitar SpaceĪfter analyzing the data on our platform, it’s clear that whenever Logic Pro X and Adobe Audition go head to head within the same category Adobe Audition has continued to be more popular over Logic Pro X. But with upon us, is Adobe Audition a auditiion competitor for Pro Tools? Adobe Audition. Pro Tools has every single option and possibility you can think of, whereas Adobe Audition can /14701.txt out to a 5. Pro Tools has no native cross-platform working pros, whereas Adobe Audition has Dynamic Linking, that works across the whole Adobe Suite.
0 Comments
We’ve rounded up 13 great tutorials showing how you can sew your own floor pillows for your home. Whether you prefer them poached, boiled, sliced or scrambled, we have a tool to help when it comes to easy cooking. Or, stack a few of them up and you’ve got an ottoman where you can rest your feet.įloor pillows can be expensive to buy – especially when you’re wanting to get several of them – but they’re relatively inexpensive to DIY. They can turn any corner into a little book nook and a soft place to read. If you are just starting out in your sewing journey, this pattern will guide you through every single step of the way. They’re great for when the kids have friends over watching movies or playing video games. It is 1 pattern, 5 sizes, and 6 possibilities giving you the most bang for your buck It is designed for sewing levels from beginning to advanced. How can you add extra seating to a room without investing in a new piece of furniture? Floor pillows! These large pillows provide a soft spot for people to sit on the floor. An Egg-cellent Apron: Free Crochet Pattern Use this FREE crochet pattern to make An Egg-cellent Apron. This fish loves open water and hiding spots, so some live rock scattered around the sides and back of the tank is also required. These fish need a tank which is at least 100 gallons, or ideally 200, meaning that they are only suited to more experienced aquarists. Blue Tangs are also susceptible to parasites so you’ll need to quarantine them before adding them to your main tank. To ensure they start feeding properly and don’t become stressed they need to be acclimatized to tank life very slowly. They reach up to 12 inches and as open swimmers like to swim around freely. You can expect one of these fish to cost in between £15 to £70, depending on whether you buy a juvenile or an adult specimen. It is a brilliant blue colour with black markings stretching from its tail to its eyes and sunshine yellow pectoral and caudal fins. About the Blue Regal TangĪlso known as the Blue Hippo Tang, the Royal Blue Tang, the Regal Tang and the Palette Surgeonfish, the Blue Tang is a very popular fish in the aquarium industry, rising to fame after the release of the films Finding Nemo and its sequel Finding Dory. Here, Robert Woods from Fishkeeping World advises that keeping such a beautiful fish in a home aquarium can be challenging, noting the key considerations to their successful care. The release of the film 'Finding Nemo' saw a rise in the popularity of ‘Dory’, the forgetful but lovable Blue Regal Tang. Having said that, here are the best free Lightroom presets for your wedding photos:Įnvira Gallery is the best WordPress Gallery plugin. These guides will help you step up your wedding photography game! For wedding photography beginners, take a look at our guide on how to take wedding photos.Īside from the Lightroom effects below, we also recommended 14 best photo editing software for photographers, and 43 Photoshop actions for wedding photographers. You may shoot amazing wedding photos for your clients, but you’ll always need to edit for the final touch. Ready to pick out some awesome, free presets? Let’s go! Lightroom Presets For Wedding Photography Presets for Product and Fashion Photography.Presets for Baby and Family Photography.Lightroom Presets for Wedding Photography.Because this is a long list of presets, feel free to use the table of contents below to navigate to a particular section: Table of Contents We’ve compiled a list of the best Lightroom presets for wedding photography, headshots, nature photography, newborn photography and more. Now, let’s take a look the our huge collection of free Adobe Lightroom effects. Looking for a place to start? Try Scott’s Lightroom presets (from the Envira team) and then download the rest of the free presets on the list. Now you can select a preset, apply it to your image, and fine tune its settings! This will allow the Presets window to pop out. Navigate to the Effects section and click the Presets tab at the bottom. Now that you’ve installed your presets, how do you apply them to your photos? Simple enough, right? How to Apply Lightroom Presets to an Image This process will install your presets to Lightroom. Simply select the presets of your choice, and click on Open to import them to Lightroom. Once you have created the folder, right click on your custom created presets folder, and select Import.Ī new window will pop up for you to locate your downloaded presets. In order to create a new folder, right click on the presets panel.Ĥ. We recommend adding a new folder so that the presets will remain organized. Go to the Preset panel on the left side of the window. Next, open Adobe Lightroom and import your photos.ģ. Here’s a step by step process on how to install Lightroom presets:ġ. First, download the Lightroom preset(s) of your choice from the list below. Once you’ve downloaded and installed Lightroom on your device, you can start browsing for presets. All you have to do is use the App to scan your physical INSTAX photos with your Smartphone and they'll be turned into sharable, digital photos that you can edit, tag and save.You can download Lightroom from Adobe’s website. Download the free INSTAX UP! App to your Smartphone for a new way to keep all your INSTAX photos digitally, in one place. When you're finished capturing memories, twist the lens again to turn the INSTAX MINI 12 instant camera off. All without compromising on image quality. And with that in mind, once you have snapped, your INSTAX MINI instant photo will eject in approximately five seconds (development time approximately 90 seconds). No need to adjust any settings, just simply fun photos every time. Plus, with automatic exposure, you can simply aim and click. When activated, the viewfinder neatly pairs up with the lens, so what you see is what you get - no object shifts in your final INSTAX photo! (FYI the fancy term for this is parallax correction.) Because when you're this close, there's no room for error. Combined with the perfectly positioned selfie mirror, automatic flash control and INSTAX MINI instant photos, the INSTAX MINI 12 instant camera is a selfie extraordinaire.īut that's not all the Close-up mode can do. Twist again and you're in Close-up mode, perfect for selfies. Not only is this iconic instant camera available in five super cute and appealing tones - Pastel Blue, Mint Green, Blossom Pink, Lilac Purple and Clay White - it's fully loaded with easy-to-use modes and controls.ĭesigned to keep up with life, the INSTAX MINI 12 instant camera is ready to go with a simple twist of the lens. The super bubbly INSTAX MINI 12 instant camera is bursting with joy, creativity and color. How can one bird be the iconic representative of an east coast, midwest, and west coast state? In contrast, only one state has embraced the California quail – that makes more sense to me. New Jersey, Iowa, and Washington have all claimed it as their state bird, which makes it feel less like a sincere and committed monogamous relationship, if you know what I mean. I have nothing against goldfinches of the double Carolinas, I just don’t have a spontaneous outpouring of affection towards them. etc.), feel free to embrace this bird, but I confess I tend to feel some bias towards the species that are more tied to a specific region. If you are capable of a Whitmanian capaciousness (“the diverse! the compact! / The Pennsylvanian! the Virginian! the double Carolinian! / O all and each well-loved by me!” etc. But colorfulness is not the only meter for affection.Īs their name of “American” goldfinch accurately suggests, this is a bird we share with the entire continent, while lesser goldfinches are a western specialty. And their colorfulness is undeniable – most yards will not see any birds more shockingly brilliant in color than a male American goldfinch in summer. Get acquainted: Most people think of this bird as the bigger, brighter, less common goldfinch, all of which tends to elevate them in the popular imagination, which loves sparkles and novelty. Practice: Male American to top left, male lesser to top right, female lessers below At all times of year and in all plumages, Americans are larger than lessers and have white, rather than yellow, feathers under the tail. Male lesser goldfinches, in contrast, do not lose their caps a bright yellow goldfinch with a dark cap from September-March or so is a lesser goldfinch. In winter, however, males lose their black foreheads and most of their color and are difficult to distinguish from females. Males in summer are easy to recognize: brilliant neon yellow with orange beaks and legs (both are dull on lesser goldfinches) and with the bright gold extending onto the back (where lessers are a duller green-yellow). Identify: As a first guideline of reasonable expectations, American goldfinches are significantly less abundant throughout Marin compared to lesser goldfinches, but will periodically appear in low numbers at most finch feeders, and may dominate in some areas near water. Join the campaign for goldfinch justice in our full profile, This Goldfinch Is Not Lesser. “Greenback” is more convivial – “there’s a big flock of greenbacks on the feeder.” I think I’ll try to revive this. I mention old names because while normal, non-birder people might casually discuss “goldfinches,” it would seem unusual for them to specify “lesser goldfinch” – it just feels too scientific, too taxonomic, not a spontaneous name that actual humans might give this bird upon seeing it. Old-fashioned, out-of-use, but less judgmental name: green-backed goldfinch. They are perhaps our second most commonly heard singer after house finches: listen to how their lively songs are more varied and disjointed than house finch songs, incorporating all kinds of different sounds and tones, including imitations of other birds. They are present year-round in our area, but tend to visit feeders much more during fall and winter. Get acquainted: These small and musical finches particularly love shelled sunflower chips and will also eat the special finch seed called Nyjer. Field guides may confuse you with various yellow birds including warblers and orioles the short answer is that if it is on your seed feeder, it’s a goldfinch. This is much the more common of our two goldfinch species (see below for the other one), widespread everywhere except densely forested areas. Both have relatively muted, green-yellow backs. Identify: Males are bright yellow and have a black cap females are a duller, somewhat green-yellow overall. Lesser Goldfinch Male lesser goldfinch – Nancy Frost In addition to the not negligible virtues of abundance and colorfulness, house finches are also superb singers: listen for their lilting, musical songs, often ending with a distinctive upslurred veeer!įor much more on linnets, see our full essay on the Blessed Halo. Dawson goes on to proclaim that “the home that is not surrounded by an investing halo of linnets, I hold it to be unblest” and I feel the same way (linnet is a nice old-fashioned name for this bird, abandoned by field guides but universally preferred among poets and bohemians). Dawson put it, “the bread-and-butter of the bird feast which life daily spreads before us.” So, 1) you almost certainly have them in your yard, and 2) that’s a nice thing. Get acquainted: The house finch is our most widespread and consistent feeder bird, or as old time ornithologist W.L. Superfect transfection reagent was from QIAGEN (Valencia, CA, USA). Anti-V5, mammalian expression plasmid pcDNA3.1/His-V5-topo, Escherichia coli Top10 competent cells and lipofectamine RNAi MAX reagent were purchased from Life Technologies (Gaithersburg, Maryland, USA). Antibodies against phospho-p38, p38, phospho-I-κB, HA tag, K48 ubiquitin, K63 ubiquitin, and ubiquitin were from Cell Signaling (Beverly, MA, USA). Anti-USP13 was purchased from Bethyl Laboratories (Montgomery, TX, USA). Anti-USP13 and anti-I-κB were purchased from ProteinTech (Chicago, IL, USA). Immobilized protein A/G beads and control IgG, anti-Sigirr (for mouse, rat, and human origin), anti-phospho-JNK1, anti-JNK1, anti-NF-κB p65, anti-GAPDH, anti-IL-1β, and anti-Lamin A/C and anti-TLR4 were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). MG-132 was from EMD Chemicals (Gibbstown, NJ, USA). Cycloheximide, leupeptin, and LPS were from Sigma Aldrich (St Louis, MO, USA). Recombinant human IL-37 (a truncated form, Lys27-Asp192) was from R&D Systems (Minneapolis, MN, USA). Human TLR4 stable transfected HEK293 (HEK293/TLR4) cells were from InvivoGen (San Diego, CA, USA). Human macrophage-like cells (monocyte-derived macrophages differentiated in vitro with M-CSF and IL-4) were purchased from StemCell Technologies (Vancouver, BC, Canada). Mouse lung epithelial cells (MLE12, SV40-immortalized mouse alveolar cell line with epithelial characteristics), RAW 264.7 cells (mouse macrophage-like virus-induced leukemia cell line), and BEAS-2B (human lung epithelial cell line) were obtained from American Type Culture Collection (ATCC, Manassas, VA). 2.3 H&E staining and immunohistochemistry C57/BL6 mice were given 50 μl lentivirus vectors (2 × 10 7 plaque-forming units per mouse) via intratracheal administration for 5 d before intratracheal challenge with LPS or PA103 (doses described above). For lentiviral vector delivery system, cDNA encoding human Sigirr was inserted into the pLVX-IRES-tdTomato vector (Clontech, Palo Alto, CA, USA) lentiviral vectors encoding Sigirr and their controls were generated with a lentivirus packaging system (Clontech, Palo Alto, CA, USA). Cytospin preparations of BAL cells were stained with hematoxylin and eosin and viewed under light microscopy for inflammatory cell differential. The cell pellets were diluted in 1 ml sterile PBS, and the cells were counted with a hemocytometer. The cell-free supernatants were harvested for ELISA assay after centrifuging at 1000 rpm for 5 min. For BAL collection, the lungs were lavaged two times with 1 ml sterile PBS at room temperature. At designated time points after LPS or PA103 challenge, the mice were anesthetized before myocardial perfusions were performed with PBS via the right ventricle until lungs were cleared of blood, and then lungs were harvested for further analyses. aeruginosa (strain PA103 1 × 10 4 colony-forming units per mouse). Briefly, mice were given intratracheal administration of LPS (1 mg per kg body weight) or P. Lung inflammation models were performed by intratracheal administration of LPS or P. All animal experiments were approved by an institutional animal care and use committee (IACUC) at the University of Pittsburgh and the Ohio State University Animal Resources Centers. aeruginosa-induced murine models of lung injuryĪll mice were housed in the specific pathogen-free animal care facility at the University of Pittsburgh and the Ohio State University in accordance with institutional guidelines and guidelines of the US National Institutes of Health. Sex-matched Usp13 +/+ and Usp13 −/− littermates at 8–10 weeks were used for animal studies. Usp13 +/− mice identified by genotyping through PCR were intercrossed for the generation of Usp13 −/− mice. The F1 Usp13 +/− mice were further crossed with C57BL/6 background for at least 6 generations before use. Chimeric offspring were crossed with C57BL/6 to generate Usp13 +/− mice. A 481 bp or an approximately 600 bp fragment was produced from the WT allele or the null allele, respectively. The potential founder F0 mice were genotyped based on genomic DNA isolated from mouse tails by PCR with the following primer sets: F52: CTAGGTGGTCCTGGGCTTTG, R52: CAGGCTCATGAGTCACCACA, and R31: ACTCACTATGGCCTCAGCAA. The RNA sequence guides are GTGTGCCCGATGTGACCTGC and TCGAGGTGGACTTATGCACA. In brief, Cas9 mRNA and two sgRNA were injected into the fertilized embryos, and then embryos in 2-cell stages were transferred to oviducts of pseudopregnant female mice. Only the Usp13 gene is localized in the position on chromosome 3 ( ). Exon 6 and Intron 18 of Usp13 (chromosome 3 between position 32,865,806 and 32,917,828) were deleted. The Usp13 −/− mice were generated by the CRISPR/Cas9 system at the University of Pittsburgh. The Lancet Regional Health – Western Pacific.The Lancet Regional Health – Southeast Asia.The Lancet Gastroenterology & Hepatology. The songs feature music from multiple Academy Award® winner Alan Menken (“Beauty and the Beast,” “Aladdin”) and lyrics by Howard Ashman, and new lyrics by three-time Tony Award® winner Lin-Manuel Miranda. “The Little Mermaid” is directed by Oscar® nominee Rob Marshall (“Chicago,” “Mary Poppins Returns”)with a screenplay by two-time Oscar nominee David Magee (“Life of Pi,” “Finding Neverland”). The film stars singer and actress Halle Bailey (“grown-ish”) as Ariel Jonah Hauer-King (“A Dog’s Way Home”) as Prince Eric Tony Award® winner Daveed Diggs (“Hamilton”) as the voice of Sebastian Awkwafina (“Raya and the Last Dragon”) as the voice of Scuttle Jacob Tremblay (“Luca”) as the voice of Flounder Noma Dumezweni (“Mary Poppins Returns”) as Queen Selina Art Malik (“Homeland”) as Sir Grimsby with Oscar® winner Javier Bardem (“No Country for Old Men”) as King Triton and two-time Academy Award® nominee Melissa McCarthy (“Can You Ever Forgive Me?” “Bridesmaids”) as Ursula. She makes a deal with the evil sea witch, Ursula, which gives her a chance to experience life on land but ultimately places her life – and her father’s crown – in jeopardy. The youngest of King Triton’s daughters and the most defiant, Ariel longs to find out more about the world beyond the sea and, while visiting the surface, falls for the dashing Prince Eric. While mermaids are forbidden to interact with humans, Ariel must follow her heart. “The Little Mermaid” is the beloved story of Ariel, a beautiful and spirited young mermaid with a thirst for adventure. The Mandalorian's second episode of the season just aired, which we described as having a "horror mood with a genuinely upsetting enemy." You can read our full review here. While Star Wars is in many ways still trying to find its identity under Disney, Iger nevertheless praised Star Wars Disney+ shows like The Mandalorian and Andor as "extremely successful." Other projects, like Rian Johnson's planned trilogy of films, remain in limbo, as the writer/director's most recent comments point to scheduling conflicts.Īs for Iger himself, he departed Disney before making a surprise return last year. After a very popular first entry with Star Wars: The Force Awakens in 2015, The Last Jedi divided fans with high reviewer ratings and low audience scores on Rotten Tomatoes in 2017, while Rise of Skywalker (2019) largely did the inverse by earning poor reviews and high marks from audiences.īetween the main saga's woes and the high profile flop that was Solo, Disney has since announced then cancelled or gone quiet on a number of would-be follow-ups, including a planned trilogy from Game of Thrones showrunners D.B. Continued abuse of our services will cause your IP address to be blocked indefinitely.The beloved space opera series has had a challenging run since its acquisition by Disney from creator George Lucas in 2012. Please fill out the CAPTCHA below and then click the button to indicate that you agree to these terms. If you wish to be unblocked, you must agree that you will take immediate steps to rectify this issue. If you do not understand what is causing this behavior, please contact us here. If you promise to stop (by clicking the Agree button below), we'll unblock your connection for now, but we will immediately re-block it if we detect additional bad behavior. Overusing our search engine with a very large number of searches in a very short amount of time.Using a badly configured (or badly written) browser add-on for blocking content.Running a "scraper" or "downloader" program that either does not identify itself or uses fake headers to elude detection.Using a script or add-on that scans GameFAQs for box and screen images (such as an emulator front-end), while overloading our search engine.There is no official GameFAQs app, and we do not support nor have any contact with the makers of these unofficial apps. Continued use of these apps may cause your IP to be blocked indefinitely. This triggers our anti-spambot measures, which are designed to stop automated systems from flooding the site with traffic. Some unofficial phone apps appear to be using GameFAQs as a back-end, but they do not behave like a real web browser does.Using GameFAQs regularly with these browsers can cause temporary and even permanent IP blocks due to these additional requests. If you are using Maxthon or Brave as a browser, or have installed the Ghostery add-on, you should know that these programs send extra traffic to our servers for every page on the site that you browse.The most common causes of this issue are: Your IP address has been temporarily blocked due to a large number of HTTP requests. Naturally, the higher the resolution the better the quality of a photo. In the world of photography, resolution is the number of pixels an image contains. Resize Photos Onlineĭigital images produced by cameras and smartphones consist of pixels. This can make the whole process quicker and easier if you always resize your images the same way. Therefore, the next time you open the Photo Resize tool, you will see the same values and options that you entered and selected during the last resizing. For instance, if you enter 60%, the photo resizer will reduce the width and height of the original image by 40%. The " Percentage" option can come in handy if you want to reduce the size of your image not to the exact pixel dimensions, but approximately. So, its resized copy will become 2500 x 1667 pixels. The size of the original photo is 5835 x 3890px. The height of your image will be changed to 2500 pixels, while its width will be reduced to a smaller number. However, if you upload the same photo, choose " Maximum width & height", and enter 2500 for width and 2500 for height, you won’t get a rectangular image as the result. Instead, it will be placed against a blurry background. But your photo won’t be awkwardly cropped. These settings will produce a rectangular image. Let’s say, you upload the same vertical image from the previous example – its size is 5835 x 3890px – and choose " Exact width & height", then enter 2500 for width and 2500 for height. The "Exact width & height" and “Maximum width & height” may seem similar, but they work differently. The width was altered automatically to preserve the aspect ratio of your original image. After the resizing process is done, you will get the image that has the height of 2000 pixels and the width of 1333 pixels. Next, you type in “2000” into the bar below. You upload a vertical photo that’s 5835 x 3890px and choose the “Exact height” option in the Output Settings. You will have control over only one value since our photo resizer will change the size of the other side automatically.įor example. With the first two options, you have to enter the exact number of width or height in pixels. In the app’s settings, you can choose one of the 5 resizing options: "Exact width", "Exact Height", "Exact width & height", "Maximum width & height" or "Percentage". Known in Japan as A6: A Ressha de Ikou 6 (A列車で行こう6).Ĭonfig fixes graphical glitches, "invincible" ships, missiles, and main cannon going through and doing zero damage to the ships. Very slight jittering on loading screen, other than that it works perfectly.Įmpty emulator configuration. Make sure that game is detected as PS2CD (Blue disc in XMB).Ĭonfig fixes freeze on Konami logo/intro FMV.Ĭonfig fixes FMV desync and auto-skipping. Minor texture problems during some scenes. Minor graphical issues during pre-rendered cutscenes, otherwise perfectly fine.Ĭonfig fixes black screen after PlayStation 2 logo.Ĭonfig fixes the loading screen freezing.ģ-Nen B-Gumi Kinpachi Sensei Densetsu no Kyoudan ni Tate!ģrd Super Robot Wars Alpha: To the End of the GalaxyĤ Edges by The Black Lotus (scene graphical demo) Cutscenes sometimes skip frames and tear in PAL version. 4 (.hack//絶対包囲 vol.4).Ĭonfig sets multitap controller ports properly.Ĭonfig sets multitap controller ports properly. 3 (.hack//侵食汚染 vol.3).Ĭonfig fixes glitches and freezes when you encounter monsters. 2 (.hack//悪性変異 Vol.2).Ĭonfig fixes glitches and freezes when you encounter monsters. 1 (.hack//感染拡大 Vol.1).Ĭonfig fixes the freeze when you enter "The World". Vol.3 歩くような速さで).Ĭonfig fixes the freeze at first location with Orca after few dialogs. Minor graphical glitches (should be fixed with the current version of config, needs confirmation).Ĭonfig fixes the freeze when entering worlds. Resources: PS2 CONFIG Database (aldo), PS2 Widescreen patches archive (devina)Ĭonfig fixes the freeze. Other lists: PS2 Classics Emulator Compatibility List (on PS4), PCSX2 Emulator, list of PS2 games (on PC), PS2 Classics for PS3 (wikipedia) This tag is intended to be used in the regions where the game wasn't released, e.g: & of a game released only in Japan. Syntax for wiki editors: Not released for this region. Compatibility counters at date: 2023 April 5 Although the reported efficiencies of thin-film silicon-based cells still lag behind those of conventional first-generation silicon cells, more developments are being conducted in order to improve their PCE to be competitive in certain applications that involve flexibility and low weight.Īll the numerical simulations are performed by employing Silvaco TCAD device simulator. Consequently, the development of thin-film c-Si solar cells will be a crucial and novel technological trend that can have several profound effects. Further, thin-film c-Si solar cells may be flexible, thereby expanding the variety of their applications. These techniques include using an antireflective coating, as well as applying nano- and micro-structures, including nanowires, nanocones, and textured structures. In order to create extremely effective thin-film c-Si solar cells, it is important to significantly thin the c-Si wafers and use recently discovered light-trapping methods to absorb incident solar radiation in thin-film c-Si devices. Yet, planar c-Si solar cells with a low thickness of 50-μm suffer from a light absorption loss because of the mismatch in the refractive index between the c-Si and the air. These thin-film c-Si cells have the advantage of being extremely cost-competitive and can be fabricated based on the traditional processes of thick c-Si solar cells. Recently, the production of thin-film c-Si cells with lower than 50-μm-thick c-Si wafers has been endeavored. Additionally, the energy band gap of silicon is 1.12 eV, which corresponds to an absorption cut-off wavelength of about 1160 nm. For several decades, silicon solar cells have represented the dominant technology in PV industries thanks to their non-toxic properties. PV technologies provide clean and reliable means to meet the ever-increasing demand for energy. Although the inclusion of ARC results in increasing V ON, it is still lower than the value of V ON for the Schottky diode encountered in current protection technology. Moreover, the simulation results depict that, by the introduction of an antireflection coating (ARC) layer, the external quantum efficiency (EQE) is enhanced and the PCE is boosted to 22.43%. The enhanced cell structure shows an improvement in the short-circuit current density ( J SC) and the open-circuit voltage ( V OC), and thus an increased power conversion efficiency (PCE) while the V ON is increased due to an increase of the J SC. The proposed solar cell is enhanced by optimizing different design parameters, such as the doping concentration and the layers’ thicknesses. Furthermore, enhancement techniques to improve the electrical and optical characteristics of the self-protected device are investigated. The ON-state voltage ( V ON) of the backward equivalent diode is found to be 0.062 V, which is lower than the value for the Schottky diode usually used as a protective element in a string of solar cells. The proposed device achieves two distinct functions where it acts as a regular solar cell at forward bias while it performs as a backward diode upon reverse biasing. To protect the solar cell against the reverse current, we introduce a novel design of a self-protected thin-film crystalline silicon (c-Si) solar cell using TCAD simulation. The reverse-biased cells consume power instead of generating it, resulting in hot spots. Current mismatch due to solar cell failure or partial shading of solar panels may cause a reverse biasing of solar cells inside a photovoltaic (PV) module. |